Sökresultat

Filtyp

Din sökning på "selling fc coins reddit Coinsnight.com FC 26 coins 30% OFF code: FC2026. Entire ordering process made very easy.618m" gav 53527 sökträffar

No title

This study aimed to obtain high-resolution 3D isotropic turbo spin-echo (TSE) wrist MRI acquisitions at 7T, with and without fat suppression, facilitated by compressed-sensing (CS) acceleration. In 16 healthy subjects, fat-suppressed (FS) and nonfat-suppressed (NFS) TSE wrist images were obtained. The protocol consisted of a SENSE-accelerated scan, with an isotropic voxel size of 0.45 mm and acqui

No title

Plant mitochondria produce the majority of adenosine triphosphate (ATP) – the cellular energy currency for metabolic reactions needed for plant growth, development, and maintenance. Despite a relatively thorough understanding of basic mitochondrial functions, many mitochondrial proteins and processes remain poorly understood. The aims of this thesis are to i) review and compare the mitochondrial u

No title

AIMS: There is considerable controversy regarding optimal management of patients with paraesophageal hiatus hernia (pHH). This survey aims at identifying recommended strategies for work-up, surgical therapy, and postoperative follow-up using Delphi methodology.METHODS: We conducted a 2-round, 33-question, web-based Delphi survey on perioperative management (preoperative work-up, surgical procedure

No title

Background: We hypothesised that observed annual incidence rates of ANCA-associated vasculitis (AAV) are driven bysporadic short-term, high-intensity rates characterised as clusters of diagnosis events in time. Using data from Ireland, Swedenand Spain, we performed a changepoint analysis to discover time intervals with high and low rates of vasculitis diagnosis.Methods: We recruited 417 patients f

No title

Mapping in situ eddy covariance measurements of terrestrial land–atmosphere fluxes to the globe is a key method for diagnosing the Earth system from a data-driven perspective. We describe the first global products (called X-BASE) from a newly implemented upscaling framework, FLUXCOM-X, representing an advancement from the previous generation of FLUXCOM products in terms of flexibility and technica

No title

Corrosion of embedded steel reinforcement is the prime influencing factor that deteriorates the structural performance and reduces the serviceability of reinforced concrete (RC) structures, especially during earthquakes. In structural elements, RC columns play a vital role in transferring the superstructure's load to the substructure. The deterioration of RC columns can affect the structures' over

No title

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

No title

This study deals with the acquisition of negation in French second language for Swedish speakers in written production. In fact, numerous studies have been dedicated to this subject, investigating learners with different first languages. However, these studies often examine the acquisition of negation in oral language. Given the difference between speaking and writing in French language, it is als

No title

Abstract The breeding season of the natterjack toad (Bufo calamita Laurenti 1768), a „prolonged breeder“, lasts up to three months in southern Sweden. However, not all reproducing individuals are present at the breeding sites during the full time span. Thus, some populations can be sub-divided into temporally isolated subpopulations using earlier or later periods of the season for reproduction. T

No title

Abstract The pharmaceutical industry is currently facing a high clinical attrition rate. In order to prevent the late-stage clinical failure, many investigations on compound quality and drug-likeness of compounds have been carried out. It has been widely accepted that molecular size and lipophilicity plays an important role in compound quality. Many attempts have been done to find out other fact

No title

Context Background Globalisation, increasing product complexity, volatile demand, and financial crisis all put strains on the supply, processing, and distribution of goods. That’s why supply chain management has become the area to focus on to gain competitive advantages and reduce costs. Saint-Gobain Sekurit Scandinavia (SGSS) is part of a large global French enterprise, Saint-Gobain that’s a worl

No title

EUs anslutning till Europakonventionen har varit föremål för diskussion ända sedan slutet av 1970-talet. På grund av bristande rättslig grund i fördragen, har anslutning dock inte varit möjligt förrän ikraftträdandet av Lissabonfördraget år 2009. Artikel 6(2) FEU föreskriver nu en skyldighet för EU att ansluta sig till konventionen under förutsättning att avtalet om Unionens anslutning avspeglar nAccession of the EU to the ECHR has been subject to discussion since the late 1970s. Due to a lack of legal basis in the treaties, accession has not been possible until the entering into force of the Treaty of Lisbon in 2009. Article 6(2) TEU now stipulates an obligation for the Union to accede to the Convention under the condition that the agreement relating to the accession makes provisions for

No title

As a major step to development, countries try to implement e-government and encouraging the public to use e-services instead of traditional ways. It is obvious that adoption of e-government has increased in many countries over the world, but the rate of adoption varies from country to country, and also the factors which are affecting the adoption of e-government differ from developing countries to

No title

Studien syftar till att beräkna det gröna, blå och grå vattenfotavtrycket vid odling och produktion av höstvete och tre fallstudier av höstvete-produkter; drivmedelsetanol, kärnvetemjöl och makaroner. Beräkningarna har utförts för Sverige under perioden 2008-2010 och täcker ungefär 80 % av den svenska produktionen av höstvete under de berörda åren. Södra Sverige delades in i 18 klimatzoner för vilThis study attempts to calculate the green blue and gray water footprint of the crop production of winter wheat and three derived winter wheat products: liquid fuel ethanol, wheat flour and macaroni. The calculations were done for Sweden for the period 2008-2010, covering an average of 80% of the annual winter wheat production. The south of Sweden was divided into 18 climate zones for which suffic

No title

Klimatförändringar förväntas öka frekvensen och intensiteten av klimatrelaterade risker, vilket i sin tur kan leda till så kallade Natech-olyckor, definierade som industriella olyckor där klimatrisker orsakar sekundära teknologiska händelser. Svenska industriverksamheter som hanterar farliga ämnen omfattas av Sevesolagstiftningen, där krav finns på att beakta sådana risker. Samtidigt är Natech-risClimate change is expected to increase the frequency and intensity of natural hazards, which in turn may lead to Natech accidents, defined as industrial accidents in which natural hazards trigger secondary technological events. Swedish industrial establishments that handle hazardous substances are subject to the Seveso legislation, which requires such risks to be taken into account. At the same ti

No title

Uppsatsen undersöker huruvida användningen av standardavtal vid offentlig upphandling av entreprenader inom Sverige innebär en inskränkning av den grundläggande unionsrättsliga friheten att tillhandahålla tjänster inom EU som säkerställs genom artikel 56 i Fördraget om Europeiska Unionens Funktionssätt. Entreprenadrätten är i Sverige oreglerad i lag och regleras istället genom standardavtal utformThis paper examines whether the use of standard agreements within public procurement of contractors in Sweden constitutes a restriction of the freedom to provide services within EU, which is ensured through article 56 in the Treaty on the Functioning of the European Union. Contract-law is not regulated through law within Sweden but is instead regulated through standard agreements developed by an i

No title

The ICT sector’s greenhouse gas emissions are comparable to those of the aviation industry, and the actors within the sector have a responsibility to reduce these in order to help combat global warming. A relatively new area of concern is the climate impact of software due to energy consumption. For example, AI has been acknowledged as an emissions-hungry technology because of the large computatio

No title

Häktning är ett straffprocessuellt tvångsmedel som används i brottsmål för att underlätta polisens och åklagarens utredning av ett misstänkt brott. Häktning innebär att en person misstänkt för ett specifikt brott får sina rättigheter inskränkta med laga stöd. Häktning är en frihetsberövande åtgärd som används trots att den misstänkte personen ännu inte är dömd. De särskilda häktningsgrunder som enThe use of detention in a remand prison is a tool of pre-trial supervision in order to facilitate the investigation of an alleged crime. The grounds for using detention in a remand prison for a person suspected for an alleged crime is the risk of the suspect continuing its criminal acts, the flight risk of the suspect and the risk of the suspect having a unduly effect on the investigation of the a

No title

Amelogenin is an enamel matrix protein which participates in the formation of dental enamel, the hardest tissue in the human body. The protein participates in this process by orienting the mineral crystals which make up the enamel and several proteolytic products from amelogenin also affect the dental enamel during its maturation. The protein is mostly hydrophobic with a hydrophilic region at the