Search results

This thesis is based on the results concerning the epitaxial growth and characterization of silicon (Si) and germanium (Ge) nanostructures. The growth technique was the Ultra High Vacuum Chemical Vapor Deposition (UHV-CVD) that works in relatively low temperatures and low growth pressures. The UHV-CVD chamber was also used for the reduction experiments. The work presented here involves three diff

In the area of adapting/constructing homes and workplaces for the physically disabled, a computer-based planning tool has been prototyped and evaluated. The prototypes so far have been based on Macintosh computers and commercially available 3-D modeling and multimedia programs. Six case-studies formed the basis for user-oriented prototyping and evaluation. The present prototype was found useful in

Popular Abstract in English There is a continuous search for reliable, robust easy to use, portable and cost effective analytical tools with applications in food industry, biomedicine, environmental monitoring and homeland security. The main focus of the thesis was on the development of electrochemical (bio)sensors designed to detect analytes of key importance from biological matrixes (e.g., fermeThere is a continuous search for reliable, robust, easy to use, portable and cost effective analytical tools with applications in food industry, biomedicine, environmental monitoring and homeland security. The main focus of this thesis is the development of electrochemical (bio)sensors and bioanalysis systems (to be applied in two major fields of interest: food & beverage industry and biomedic

As farms are getting bigger with more animals, less manual supervision and attention can be given the animals on both group and individual level. In order not to jeopardize animal welfare, automated supervision is in some way already in use. Function and control of ventilation is already in use in modern pig stables, e.g. by the use of sensors for temperature, relative humidity and malfunction con

European renewable energy policy has gone through a remarkable development over the last few years. It has moved from being a predominantly national-level concern with a focus on environmental issues to a top European policy agenda item where security of supply and competitiveness concerns figure with equal prominence. In 2007 and 2008 EU established a very forceful policy framework with ambitiou

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

This study investigates how communication consultants struggle to reconstruct their professional role in the digital media landscape. The extant literature on professional roles in public relations has a tendency to render roles as static pregivens. Therefore, the purpose of this study is to contribute conceptually and empirically to role research by focusing on the process of “role-making” and ho

Abstract The circular distribution of the willow warbler Phylloscopus trochilus around the Baltic Sea shares many features with the classic examples of ring species; however, the system is much younger. It has previously been shown that a secondary contact zone is located in central Scandinavia, where there are narrow clines for several morphological traits coincident with a migratory divide. Here

Background and purpose The introduction of Monte Carlo (MC) techniques for treatment planning and also for verification purposes will have considerable impact on the radiation therapy planning process. The aim of this work was to use a virtual accelerator to study the performance of a MC-based electron dose calculation algorithm, implemented in a commercial treatment planning system. Methods The

This article aims to analyse how innovative, individual actions influence the evolution of local industries according to three stages. When discussing the evolution of industries or economies, the concept of path dependency is often a central element. Its vague nature makes it however difficult to be used as an interpretative lens when studying the evolution of local industries. In order to limit

Diffusion kurtosis imaging (DKI) is an emerging technique with the potential to quantify properties of tissue microstructure that may not be observable using diffusion tensor imaging (DTI). In order to help design DKI studies and improve interpretation of DKI results, we employed statistical power analysis to characterize three aspects of variability in four DKI parameters; the mean diffusivity, f

Pore formation and pore closure in poly(D,L-lactide-co-glycolide)-based drug delivery systems are two important processes as they control the release of the encapsulated drug. The phenomenon pore closure was investigated by studying the effects of the pH and the temperature of the release medium, and the properties of the polymer. Poly(D,L-lactide-co-glycolide) (PLG) films were subjected to a pore

This work utilizes a combination of theory and experiments to explore the adsorption of two different cationic polyelectrolytes onto oppositely charged silica surfaces at pH 9. Both polymers, poly(diallyldimethylammonium chloride), PDADMAC, and poly(4-vinyl N-methylpyridinium iodide), PVNP, are highly charged and highly soluble in water. Another important aspect is that a silica surface carries a

Arctic areas of deep-water convection have a large potential for export of organic carbon from surface waters into the deep sea and, therefore, are an important part of the global carbon cycle. As the Arctic is reportedly heating up faster than any other part of the planet, temperature-driven changes in the biogeochemical cycling in these areas can be very significant. Here, we study the regulatio

The use of artificial neural networks (ANNs) in problems related to water resources has received steadily increasing interest over the last decade or so. The related method of the self-organizing map (SOM) is an unsupervised learning method to analyze, cluster, and model various types of large databases. There is, however, still a notable lack of comprehensive literature review for SOM along with

In peatlands the balance between litter input and decay loss in the oxic acrotelm determines the rate of carbon input to the anoxic catotelm with carbon lost at very slow rate. In the acrotelm the C/N-quotient decreases with depth and indicates the loss of carbon from the acrotelm. On one boreo-nemoral and three subalpine ombrotrophic bogs in Sweden the carbon losses in the acrotelm plus the appar