Filetype
In this paper, we consider positioning with observed-time-difference-of-arrival (OTDOA) for a device deployed in long-term-evolution (LTE) based narrow-band Internet-of-things (NB-IoT) systems. We propose an iterative expectation- maximization based successive interference cancellation (EM-SIC) algorithm to jointly consider estimations of residual frequency- offset (FO), fading-channel taps and ti
Wohlers Associates, Inc., recognized widely as the leading consulting firm and preeminent authority on additive manufacturing and 3D printing worldwide—terms that are used interchangeably—today announced the publication of the Wohlers Report 2016. The 2016 edition marks the 21st consecutive year of its availability. According to Wohlers Report 2016, the additive manufacturing (AM) industry, consis
In order to obtain better performance, gas turbines always operate with high inlet temperature. This contributes to a high level of thermal load on the first stage vane endwall. To ensure safe operation of a gas turbine within a proper temperature range, the cooling performance of the vane endwall must be further investigated. In the present study, effects of the mainstream turbulence and upstream
Two-dimensional (2D) spectroscopy has been intensively used to study electronic and vibronic coherences in biological systems and semiconductors. This technique studies coherent as well as incoherent signals that arise from the nonlinear interaction of a sequence of laser pulses. In this paper we present a direct evaluation of the 2D signal based on elementary quantum kinetics in order to compare
Popular Abstract in Swedish Två mobila system, ett svenskt och ett italienskt, för undersökning av historiska fasader har använts för att undersöka möjligheten till identifiering av olika material, biologisk påväxt och faktorer som i framtiden kan leda till nedbrytning av kulturhistoriskt värdefulla monument. Undersökningarna visade på möjligheter att genomföra analyser av ytor med hjälp av fluoreThe on-site documentation and examination of architectural heritage has presented challenges for traditional analysis methods in the form of, among other things, large complex structures, sites and environmental conditions. In recent years there has been growing interest in assessing progressing deterioration processes and material analysis, with an emphasis on sustainable conservation and mainten
Popular Abstract in Swedish En av de mest fundamentala funktionerna för vårt långtidsminne är funktionen att kunna plocka fram ett specifikt minne när vi stöter på en ledtråd som är relaterad till detta minne. Ett vardagsexempel på sådan ledtrådsstödd långtidsminnesframplockning är om en vän frågar dig hur långt ett maraton är (en ledtråd som sökningen i långtidsminnet kan baseras på) och du lyckaA fundamental function of long-term memory is the ability to retrieve a specific memory when encountering a retrieval cue. The purpose of this dissertation was to further our understanding of such cued recall by investigating the temporal dynamics from the presentation of the retrieval cue until the target memory is recalled. Retrieval cues are often related with several memories. When such a retr
Viewed from one angle the establishment of Trump's Menie Estate golf resort in Aberdeenshire signals a massive investment in a rather peripheral site within the region. Menie Estate itself was previously used as a shooting estate while the land to be developed is mainly farmland and coastal sand dunes. Part of these sand dunes are however designated environmental protection as a Site of Special Sc
This work presents a methodology for designing online web presentations reusing a large scale, interactive and immersive VR installation by mapping assets as well as interactions to a low capability environment. With the emergence of WebGL plugin-free interactive 3D graphics inside limited information processing environments, e.g. browser technologies, becomes reality. However, macro VR worlds typ
This article addresses the short-term decay of advecting-diffusing scalar fields in Stokes flows. The analysis is developed in two main subparts. In the first part, we present an analytic approach for a class of simple flow systems expressed mathematically by the one-dimensional advection-diffusion equation w(y)∂ξ=É∂y2+iV(y)-É′, where ξ is either time or axial coordinate and iV(y) an imaginary pot
This paper presents a 2-dimension (2-D) Vernier time-to-digital converter (TDC) which uses two 3-stage gated-ring-oscillators (GROs) in the X/Y Vernier branches. The already small Vernier quantization noise (~10.6ps) is improved by the 1st-order noise shaping of the GRO. Moreover, since all delay differences between X phases and Y phases can be used (rather than only the diagonal line of the 1-dim
The ESS elliptical superconducting Linac consists of two types of 704.42 MHz cavities, medium and high beta, to accelerate the beam from 216 MeV (spoke cavity Linac) up to the final energy at 2 GeV. The last Linac optimization, called Optimus+, has been carried out taking into account the limitations of SRF cavity performance (field emission). The medium and high-beta parts of the Linac are compos
Popular Abstract in English There is a continuous search for reliable, robust easy to use, portable and cost effective analytical tools with applications in food industry, biomedicine, environmental monitoring and homeland security. The main focus of the thesis was on the development of electrochemical (bio)sensors designed to detect analytes of key importance from biological matrixes (e.g., fermeThere is a continuous search for reliable, robust, easy to use, portable and cost effective analytical tools with applications in food industry, biomedicine, environmental monitoring and homeland security. The main focus of this thesis is the development of electrochemical (bio)sensors and bioanalysis systems (to be applied in two major fields of interest: food & beverage industry and biomedic
European renewable energy policy has gone through a remarkable development over the last few years. It has moved from being a predominantly national-level concern with a focus on environmental issues to a top European policy agenda item where security of supply and competitiveness concerns figure with equal prominence. In 2007 and 2008 EU established a very forceful policy framework with ambitiou
Environmental policy is shifting the focus from production processes to product-related issues. The provision and use of environmental information is generally considered an essential element in addressing the environmental impacts associated with the life cycle of products. Environmental product declarations (EPD) are one of the much promoted informative instruments. A wide range of self-declarat
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
This document presents the results of a literature review performed in order to assess the suitability of different evacuation modelling tools for the calculation of evacuation times and assessment of fire safety in underground physics research facilities. This document is part of the research collaboration between Lund University and the European Organization for Nuclear Research (CERN), concerni
The Rome Statute of the International Criminal Court was adopted July 17, 1998at the Rome Conference. The Statute entered into force July 1, 2002, after that 60 States had ratified the Statute. The International Criminal Court (ICC) has now established an administration in order to be able to fulfil its mission, its mandate: Affirming that the most serious crimes of concern to the international co
Rwanda har den högsta andelen kvinnliga parlamentariker i världen. 2008 antogs en ny lag om genusbaserat våld in Rwandas parlament. Den här kandidatuppsatsen undersöker hur kvinnor i Rwanda upplever effekterna av lagen i relation till deras handlingsutrymme och politiska självbestämmande, empowerment. En fältstudie genomfördes under april- maj 2010 med syfte att samla material om kvinnors erfarenhRwanda has the highest representation of female parliamentarians in the world. In 2008, a law against gender based violence passed the floor in the Rwandan government. This bachelor’s thesis examines how women in Rwanda experience the effects of this law in terms of their own perceived acting space(s) and empowerment. A minor field study was carried out in Rwanda April-May 2010 in order to gather
In the globalised world there is a keen competition market prevailing, which request higher demands on the entrepreneurs within the building sector. Research shows that 30-35 % of the production costs on the building sites is waste, which means non-profit value for the costumer. This example shows both hidden and visible costs, which has been identified on building constructions sites. To reduce t
