Search results

Contents Department of Construction Sciences Division of Solid Mechanics ISRN LUTFD2/TFHF-06/5127-SE(1-63) Finding general guidelines for choosing appropriate cut-off frequencies for modal analyses of railway bridges trafficked by high-speed trains Master’s Dissertation by Björn Lundin and Philip Mårtensson Supervisors Johan Kölfors, Scanscot Technology, Sweden Håkan Hallberg, Div. of Solid Me

https://www.solid.lth.se/fileadmin/hallfasthetslara/utbildning/examensarbete/TFHF5127.pdf - 2026-07-09

My Meeting with a Former ISIL Sex Slave Skip to content Search for: Search Button Home About Us Who We Are Our History About Raoul Wallenberg Our Theory of Change Staff Opportunities Annual Reports Whistleblower Our work What we do Multi-Disciplinary Research Higher Education Strategic Advice and Analysis Outreach Evaluation of Programme Work Methods Focus Areas Business and Human Rights Internati

https://rwi.lu.se/2016/03/15/my-meeting-with-a-former-isil-sex-slave/ - 2026-07-10

Film Festival: International Day of the Girl Child - The Raoul Wallenberg Institute of Human Rights and Humanitarian Law Skip to content Search for: Search Button Home About Us Who We Are Our History About Raoul Wallenberg Our Theory of Change Staff Opportunities Annual Reports Whistleblower Our work What we do Multi-Disciplinary Research Higher Education Strategic Advice and Analysis Outreach Eva

https://rwi.lu.se/news/film-festival-international-day-of-the-girl-child/ - 2026-07-10

Purpose: The sugar industry is always pressured to be suitable and enhance its operational effectiveness. Digital Twin (DT) has the potential to transform this industry. However, the lack of industry-specific Key Performance Indicator (KPI) frameworks makes it challenging to implement them. This study provides a hierarchical KPI model for DT adoption in the sugar sector, interconnecting the United

Tree roots and their fungal symbionts mediate the response of rhizosphere soil organic carbon (SOC) decomposition to climate warming, specifically the temperature sensitivity of soil microbial respiration (Q10), which is a critical parameter for projecting the magnitude of terrestrial soil C-climate feedbacks. However, the intensity of the rhizosphere effects (RE; rhizosphere soils vs. bulk soils)

BACKGROUND: Hormone receptor positivity predicts benefit from endocrine therapy but the knowledge about the long-term survival of patients with different tumor receptor levels is limited. In this study, we describe the 25 years outcome of tamoxifen (TAM) treated patients.PATIENTS AND METHODS: Between 1983 and 1992, a total of 4,610 postmenopausal patients with early-stage breast cancer were random

Aims: To analyse dosimetric and clinical predictors for acute and late gastrointestinal toxicity following chemoradiotherapy of anal cancer. Materials and methods: Consecutive patients with locally advanced (T2 ≥4 cm – T4 or N+) anal cancer were selected from an institutional database (n = 114). All received intensity-modulated radiotherapy with concomitant 5-fluorouracil and mitomycin C. Gastroin

N-acylated substituted β 3 oligoamides are known to form unique supramolecular nanorods based on a 3-point hydrogen bond self-assembly motif. This motif is an intermolecular extension of the hydrogen bonding network that stabilizes the 14-helix secondary structure unique to β 3 oligoamides. Acetylation of the N-terminus of the molecule provides the necessary third hydrogen bond pair of the motif.

Cryptosystems based on the learning with errors (LWE) problem are assigned a security level that relates to the cost of generic algorithms for solving the LWE problem. This includes at least the so-called primal and dual lattice attacks. In this paper, we present an improvement of the dual lattice attack using an idea that can be traced back to work by Bleichenbacher. We present an improved distin

In this concluding chapter, our aim is to outline the state-of-the-art within the deliberated topic in order to identify challenges for future research. Firstly, reminiscent of George Orwell’s aphorism “who controls the past controls the future”, we stress the importance of research into the origins of degraded and restituted towns in order to understand the socio-economic context that has shaped

Acute leukemia refers to a group of aggressive hematological malignancies of myeloid and lymphoid lineages termed acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL) respectively. Acute leukemia is characterized by the presence of underlying genetic aberrations which alter the biology of normal hematopoietic cells resulting in the accumulation of immature abnormally differentiated blast

Objectives: This study evaluated if selecting the left ventricular (LV) target segment by echocardiography-derived late mechanical activation, with access to multimodality imaging for scar and venous anatomy, could help to increase responder rates to cardiac resynchronization therapy (CRT). Background: LV lead placement is important for clinical outcome, but the optimal strategy for LV lead placem

BACKGROUND: Malignant melanoma is the most deadly form of skin cancer. Female sex is known to have a protective effect on incidence, tumour characteristics, and mortality from melanoma. However, the potentially modifying effect of sex on the prognostic significance of clinicopathological and investigative factors is generally not taken into consideration in biomarker studies. In this study, we com

Background: Pressure–volume (PV) loops provide comprehensive information of cardiac function, but commonly implies an invasive procedure under general anesthesia. A novel technique has made it possible to non-invasively estimate PV loops with cardiac magnetic resonance (CMR) and brachial pressure which would enable good volume estimation of often anatomically complex ventricles without the need of

Objectives. Nearly half of men with clinically localized prostate cancer are understaged. We evaluated whether knowledge of preoperative free prostate-specific antigen (f-PSA), complexed (c-PSA), and total (t-PSA) concentrations or the ratios thereof (f-PSA/t-PSA, c-PSA/t PSA, and f PSA/c- PSA) could improve upon the staging of prostate cancer when compared with standard PSA testing (t-PSA). In ad

Background: Intermediate care is often defined as healthcare occurring somewhere between traditional primary (community) and secondary (hospital) care settings. High quality intermediate care is important in dementia, may prevent caregiver burnout and also lead to optimal care for people with dementia. However, very little is known about the point of intermediate care for persons with dementia in

Denna avhandling behandlar spridning av lätta mesoner i fallet där antalet externa mesoner överstiger fyra (d.v.s. tre eller fler partiklar i initial- eller finaltillståndet), beräknat genom kiral störningsräkning. Detta är både av teoretiskt intresse inom studien av spridningsamplituder, och relevant för system av tre eller fler pioner som simuleras genom gitter-kvantkromodynamik.Introduktionen hThis thesis concerns scattering of light mesons in the case where the number of external particles exceeds four (that is, three or more particles in the initial or final state), calculated using chiral perturbation theory.This is both of theoretical interest in the study of scattering amplitudes, and relevant for systems of three or more pions simulated using lattice quantum chromodynamics.The int

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Professor Contact details Email: daniel [dot] topgaard [at] chem [dot] lu [dot] se Phone: +46 46 222 82 04Organisation Physical Chemistry Service point: 1 WebpageDaniel Topgaards profile in Lund University research portalOther affiliations Health and safety representative Physical ChemistrySelected publicationsD. Topgaard. Skin, soap, and spaghetti: investigations of co-existing solid and liquid p

https://www.physchem.lu.se/daniel-topgaard - 2026-07-09

Background: Celiac disease often goes undiagnosed. Mass screening might be an option to reduce the public health burden of untreated celiac disease. However, mass screening is still controversial since it is uncertain whether the benefits of early detection outweigh the possible negative consequences. Before implementation of screening programs, the experiences of those being identified as cases s