Search results

Popular Abstract in English Imagine a solar powered flash light. Each photon absorbed by the flash light’s solar cell creates electric energy and the flash light’s light source converts the electrical energy again into photons. The purpose of such a device may be questionable, because you would be surprised if it would create more light than what it absorbs. However, under certain conditions it isIn this thesis the luminescence properties of highly doped semiconductors are studied with focus on degenerately n-doped InP. It is demonstrated how photoluminescence measurements on degenerately doped semiconductors allow an estimation of the doping concentration without need for electrical contacts. The degenerate doping can furthermore reveal the conduction band structure for energies higher th

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Popular Abstract in Swedish From an economic viewpoint, derivatives and credit-extension instruments are the basic building blocks of all financial instruments. By structuring these building blocks in various combinations, it is possible to attain the economic substance of any conventional financial instrument – regular shares or bonds, as well as more complex financial instruments such as contingThe aim of this book is to examine the Swedish income tax treatment of derivatives, to ascertain the extent to which this treatment provides tax arbitrage opportunities, and to present possible solution that may prevent existing arbitrage opportunities. This study establishes that there are two types of financial instruments that constitute the greatest challenges regarding tax arbitrage opportuni

Background: At birth, infants' lungs are fluid-filled. For newborns to have a successful transition, this fluid must be replaced by air to enable effective breathing. Some infants are judged to have inadequate breathing at birth and are resuscitated with positive pressure ventilation (PPV). Giving prolonged (sustained) inflations at the start of PPV may help clear lung fluid and establish gas volu

Background: Clinical egg allergy is a common food allergy. Current management relies upon strict allergen avoidance. Oral immunotherapy might be an optional treatment, through desensitization to egg allergen. Objectives: To determine the efficacy and safety of oral and sublingual immunotherapy in children and adults with immunoglobulin E (IgE)-mediated egg allergy as compared to a placebo treatmen

The structure tensor is a powerful tool describing the local intensity structure of an image or image sequence. In this paper we give a model for the noise distribution of the components of the tensor. In order to do so we have also investigated some properties of the gamma distribution. We show that, given an input image corrupted with Gaussian noise, the noise in the structure tensor can be mode

The invention relates to a method of 13C-MR detection using an imaging medium comprising hyperpolarised 13C-lactate and to an imaging medium containing hyperpolarised 13C1-lactate for use in said method.

This paper deals with limitations on control system performance due to load disturbances, measurement noise, actuator saturation and system dynamics. Simple problems which capture the essence of the problem are formulated and solved. The results make it possible to quickly explore a design problem for preliminary assessment before attempting to do massive computations. They are also useful ingredi

It is established that the glomerular filter sieves macromolecules based on their size, shape, and charge. Anionic proteins are thus retarded compared with their neutral or cationic counterparts. However, recent studies have indicated that charge effects are small, or even "anomalous," for polysaccharides. We therefore investigated the impact of charge on the glomerular permeability to polysacchar

Abstract in UndeterminedThe success of the Wii and of the iPhone together with the persisting problem of displaying information on the small screens of mobile devices is currently pushing the development of non-visual interaction channels such as gestures, tactile/haptic interaction and sound. This development presents both potential and risk, since new channels of interaction may result either in

Popular Abstract in English Nowadays, the majority of energy production comes from combustion which is universally linked to daily human activities. Public awakening of the environmental effects of combustion pollution evokes extensive research activities in improving combustion efficiency and reducing pollutant production. Development of combustion processes also includes the use of renewable bioThe work presented in the thesis concerns the developments of laser-based diagnostics and its application to the study of turbulent premixed combustion. The diagnostic developments, mainly concerned with planar laser-induced fluorescence (PLIF), are intended to provide instantaneous visualization of the key species originating from the combustion processes involved in the burning of hydrocarbons

We propose a description of nonequilibrium systems via a simple protocol that combines exchange-correlation potentials from density functional theory with self-energies of many-body perturbation theory.The approach, aimed to avoid double counting of interactions, is tested against exact results in Hubbard-type systems, with respect to interaction strength, perturbation speed and inhomogeneity, andWe propose a description of nonequilibrium systems via a simple protocol that combines exchange-correlation potentials from density functional theory with self-energies of many-body perturbation theory. The approach, aimed to avoid double counting of interactions, is tested against exact results in Hubbard-type systems, with respect to interaction strength, perturbation speed and inhomogeneity, an

Background Smokers have a substantially increased risk of postoperative complications. Preoperative smoking intervention may be effective in decreasing this incidence, and surgery may constitute a unique opportunity for smoking cessation interventions. Objectives The objectives of this review are to assess the effect of preoperative smoking intervention on smoking cessation at the time of surgery

Life oil earth was formed during billions of years, exposed to, and shaped by the original physical forces such as gravitation, cosmic irradiation, atmospheric electric fields and the terrestrial magnetism. The Schumann resonances at 7.4 Hz are all example of oscillations possibly important for life.(1)) The existing organisms are created to function in harmony with these forces. However, in the l

Up to recently mobile gamma spectrometry has mostly been performed with NaI(Tl)-based detector systems. However lately the interest of using HPGe(High Purity Germanium)-based systems have increased and one has realised that the excellent energy resolution of HPGe-detectors, in combination with the possibility to manufacture larger crystals than before, is an advantage not only when performing in s

The role and activities of the European Court of Justice (EJC) have been discussed for couple of decades now. Without any doubt the role that ECJ fulfils today in the European Community is not what it was in the beginning of its existence and perhaps not even what was strictly prescribed by the EC Treaty. In the present thesis will be firstly examined, how the present role of the ECJ, as a quasi-c

AbstractObjective: This article presents a summary of the 2025 Swedish prostate cancer guidelines, focusing on recurrence after local treatment, metastatic disease, and castration-resistant prostate cancer.Results: The 2025 Swedish guidelines introduce several important updates. Prostate specific membrane antigen (PSMA)-PET/CT is recommended only when PSA exceeds 0.2 µg/L, and reporting should fol